Skip to main content

SB39
(Bacterial strain #235121)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 235121 Bacteria in agar stab 1 $94

Backbone

  • Vector backbone
    n/a
  • Vector type
    This is a strain, not a plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SB39
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ]

Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT).

Strain validation:
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp.
- PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp.
- PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SB39 was a gift from Oscar Ramos (Addgene plasmid # 235121)
  • For your References section:

    Optimized Quantitative Bacterial Two-Hybrid (qB2H) for Protein-Protein Interaction Assessment. Guyot A, Maillard E, Ferreira-Pinto K, Plancon-Arnould L, Nadaradjane AA, Guerois R, Ochsenbein F, Martin L, Ramos OHP. Comput Struct Biotechnol J. 2026 May 25;35(1):0098. doi: 10.34133/csbj.0098. eCollection 2026. 10.34133/csbj.0098 PubMed 42199375