Skip to main content

pME_Cp_0_3b_026_Flag-tag
(Plasmid #235879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 235879 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pME_Cp_UAV_GFP
  • Backbone size w/o insert (bp) 2101
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLAG N-tag
  • Species
    Synthetic
  • Insert Size (bp)
    89

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CGTATCACGAGGCAGAATTTC
  • 3′ sequencing primer CCTGCATAACGCGAAGTAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.05.08.593163 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME_Cp_0_3b_026_Flag-tag was a gift from Tobias Erb (Addgene plasmid # 235879 ; http://n2t.net/addgene:235879 ; RRID:Addgene_235879)
  • For your References section:

    A modular high-throughput approach for advancing synthetic biology in the chloroplast of Chlamydomonas. Inckemann RM, Chotel T, Burgis M, Brinkmann CK, Andreas L, Baumann J, Sharma P, Klose M, Barrett J, Ries F, Paczia N, Glatter T, Mackinder LCM, Willmund F, Erb TJ. Nat Plants. 2025 Nov;11(11):2332-2349. doi: 10.1038/s41477-025-02126-2. Epub 2025 Nov 3. 10.1038/s41477-025-02126-2 PubMed 41184475