pSB-XPRESSO-hSpCas9-EGFP
(Plasmid
#237298)
-
PurposeSleeping Beauty XPRESSO vector for Cas9-EGFP expression
-
Depositing Lab
-
Depositing OrganizationTechnion - Israel Institute of Technology
Located in Israel -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 237298-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 237298-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 8050
- Total vector size (bp) 13113
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
SpeciesStretococcus pyogenes
-
Insert Size (bp)4193
-
Entrez Genecas9 (a.k.a. SD90_RS03825, SD90_03830)
- Promoter CAG
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKowarz et al. Addgene plasmid #60513. Ran et al. Addgene plasmid #48138
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 237298-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 237298-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-XPRESSO-hSpCas9-EGFP was a gift from Lior Gepstein (Addgene plasmid # 237298 ; http://n2t.net/addgene:237298 ; RRID:Addgene_237298) -
For your References section:
XPRESSO: Rapid genetic engineering of human pluripotent stem cells for durable overexpression using a modular anti-silencing vector. Wexler Y, Grinstein H, Huber I, Glatstein S, Ghiringhelli M, Edri O, Landesberg M, Shiff D, Arbel G, Rosh I, Choudhary A, Stern S, Gepstein L. Stem Cell Reports. 2025 Aug 19:102603. doi: 10.1016/j.stemcr.2025.102603. 10.1016/j.stemcr.2025.102603 PubMed 40845851