Vtc2p_SPX_WT
(Plasmid
#237893)
-
PurposeBacterial expression Vtc2p_SPX_WT as positive control for PP-InsP binding assays
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMH (pET24d-based)
- Backbone size w/o insert (bp) 5206
- Total vector size (bp) 5779
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVtc2p_SPX_1-182
-
Alt namevtc2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)546
-
Entrez GeneVTC2 (a.k.a. YFL004W, PHM1)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRebekka Wild, doi: 10.1126/science.aad9858
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Vtc2p_SPX_WT was a gift from Michael Hothorn (Addgene plasmid # 237893 ; http://n2t.net/addgene:237893 ; RRID:Addgene_237893) -
For your References section:
The Use of Grating-Coupled Interferometry to Study Inositol Pyrophosphate-Protein Interactions. Sturm K, Hothorn M. Methods Mol Biol. 2025;2972:153-169. doi: 10.1007/978-1-0716-4799-8_12. 10.1007/978-1-0716-4799-8_12 PubMed 40879985