PE2_lenti
(Plasmid
#237895)
-
PurposePrime Editor in lentiviral backbone
-
Depositing Lab
-
Depositing OrganizationMartin-Luther-Universitaet Halle-Wittenberg, Faculty of Medicine
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBR322
- Total vector size (bp) 16343
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePE2
-
Alt nameCas9 (H840A)-RT
-
Alt nameCas9(H840A)-M-MLVrt
-
SpeciesSynthetic
-
Insert Size (bp)6354
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcaggtgtcgtgacgtacggccaccatgaaacggacagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PE2_lenti was a gift from Michael Boettcher (Addgene plasmid # 237895 ; http://n2t.net/addgene:237895 ; RRID:Addgene_237895)