Skip to main content

pTol1-U6abc_ect2_cmlc2-nmKate
(Plasmid #238410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 238410 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 238410-D50 50 μg of DNA in Tris buffer $495
DNA 238410-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Tol1-based backbone
  • Total vector size (bp) 6610

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nuclear mKate/3 gRNAs targeting ect2
  • gRNA/shRNA sequence
    gA: CGGCAGGAGGCCCCAGGATACGG; gB: GCAGGTGGGCGGCCCCATTCTGG; gC: GTGCTCACTTGGACCGAGTCAGG
  • Species
    D. rerio (zebrafish)
  • Promoter cmlc2 (nmKate); U6 (gRNAs)

Cloning Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol1-U6abc_ect2_cmlc2-nmKate was a gift from Juan Manuel González-Rosa (Addgene plasmid # 238410 ; http://n2t.net/addgene:238410 ; RRID:Addgene_238410)
  • For your References section:

    Rapid and robust generation of cardiomyocyte-specific crispants in zebrafish using the cardiodeleter system. Keeley S, Fernandez-Lajarin M, Bergemann D, John N, Parrott L, Andrea BE, Gonzalez-Rosa JM. Cell Rep Methods. 2025 Mar 24;5(3):101003. doi: 10.1016/j.crmeth.2025.101003. 10.1016/j.crmeth.2025.101003 PubMed 40132543