pTol1-U6abc_ect2_cmlc2-nmKate
(Plasmid
#238410)
-
PurposeDrives expression of 3 different gRNAs targeting ect2, and expression of nuclear mKate in cardiomyocytes
-
Depositing Lab
-
Depositing OrganizationBoston College
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 238410-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 238410-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneTol1-based backbone
- Total vector size (bp) 6610
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenuclear mKate/3 gRNAs targeting ect2
-
gRNA/shRNA sequencegA: CGGCAGGAGGCCCCAGGATACGG; gB: GCAGGTGGGCGGCCCCATTCTGG; gC: GTGCTCACTTGGACCGAGTCAGG
-
SpeciesD. rerio (zebrafish)
- Promoter cmlc2 (nmKate); U6 (gRNAs)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 238410-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 238410-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol1-U6abc_ect2_cmlc2-nmKate was a gift from Juan Manuel González-Rosa (Addgene plasmid # 238410 ; http://n2t.net/addgene:238410 ; RRID:Addgene_238410) -
For your References section:
Rapid and robust generation of cardiomyocyte-specific crispants in zebrafish using the cardiodeleter system. Keeley S, Fernandez-Lajarin M, Bergemann D, John N, Parrott L, Andrea BE, Gonzalez-Rosa JM. Cell Rep Methods. 2025 Mar 24;5(3):101003. doi: 10.1016/j.crmeth.2025.101003. 10.1016/j.crmeth.2025.101003 PubMed 40132543