pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
(Plasmid
#239030)
-
PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 6764
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesesRNA for mouse VGAT
-
gRNA/shRNA sequencecctggtccttggagccagagggtggcagaggagcgccgccgcgctgataatgaatgtctccctcgacgggagcttctgcgccctcgtctccgcagggctcgccttccgatttcaggatgtccatctgcaggccctggcgatgctcaaagtcgagatcgtcgcagtgcgcgaagcccaccgcttcctcatcggtAgccgcctgaaaccccatcctAgcaaacatgccgctcaccttggcctgggacttgttggacacggaggtggccacattggtcagcttgctgcggagcagggtggcca
-
SpeciesM. musculus (mouse)
-
Entrez GeneSlc32a1 (a.k.a. VGAT, Viaat)
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer catcacctcccacaacgagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE was a gift from Josh Huang (Addgene plasmid # 239030 ; http://n2t.net/addgene:239030 ; RRID:Addgene_239030) -
For your References section:
Programmable RNA sensing for cell monitoring and manipulation. Qian Y, Li J, Zhao S, Matthews EA, Adoff M, Zhong W, An X, Yeo M, Park C, Yang X, Wang BS, Southwell DG, Huang ZJ. Nature. 2022 Oct;610(7933):713-721. doi: 10.1038/s41586-022-05280-1. Epub 2022 Oct 5. 10.1038/s41586-022-05280-1 PubMed 36198803