Skip to main content

P521_VSX2_p2A-h2b_mRuby3
(Plasmid #239104)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239104 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5091
  • Modifications to backbone
    A p2A-h2b-mRuby3 sequence was added in-frame before the stop codon of the endogenous VSX2 gene by Gibson assembly. This plasmid also has a human U6 promoter with a VSX2 targeting guide RNA and scaffold for Cas9 targeting.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSX2
  • Alt name
    CHX10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5091
  • Entrez Gene
    VSX2 (a.k.a. CHX10, HOX10, MCOP2, MCOPCB3, RET1)
  • Promoter Endogenous VSX2 promoter
  • Tag / Fusion Protein
    • -p2A-h2b-mRuby3 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTAGTGCGCGAGCAAAAT
  • 3′ sequencing primer GCCTAGGCGGTATCTTCACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P521_VSX2_p2A-h2b_mRuby3 was a gift from Karl Wahlin (Addgene plasmid # 239104 ; http://n2t.net/addgene:239104 ; RRID:Addgene_239104)
  • For your References section:

    Chromatin Accessibility and Transcriptional Differences in Human Stem Cell-Derived Early-Stage Retinal Organoids. Jones MK, Agarwal D, Mazo KW, Chopra M, Jurlina SL, Dash N, Xu Q, Ogata AR, Chow M, Hill AD, Kambli NK, Xu G, Sasik R, Birmingham A, Fisch KM, Weinreb RN, Enke RA, Skowronska-Krawczyk D, Wahlin KJ. Cells. 2022 Oct 28;11(21):3412. doi: 10.3390/cells11213412. 10.3390/cells11213412 PubMed 36359808