Skip to main content

pAAV-Egr1-CytoTape-V5
(Plasmid #239428)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 239428 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Egr1
  • Backbone manufacturer
    Epoch Life Science, Inc.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CytoTape-V5
  • Species
    Synthetic
  • Entrez Gene
    EGR1 (a.k.a. AT225, G0S30, KROX-24, NGFI-A, TIS8, ZIF-268, ZIF268, ZNF225)
  • Promoter Egr1 promoter
  • Tag / Fusion Protein
    • V5-dMBP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
  • 3′ sequencing primer GCAAACAACAGATGGCTGGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Egr1-CytoTape-V5 was a gift from Changyang Linghu (Addgene plasmid # 239428 ; http://n2t.net/addgene:239428 ; RRID:Addgene_239428)
  • For your References section:

    Scalable and multiplexed recorders of gene regulation dynamics across weeks. Zheng L, Shi D, Yan Y, Zhou B, Lim J, Hou Y, An B, Adhinarta JK, Lin M, Ko B, Joesten WC, Gautam M, Huez EDM, Kim EC, Klyder EG, Chang B, Pitchiaya S, Roberts MT, Cai DJ, Boyden ES, Wei D, Lio P, Linghu C. Nature. 2026 Jan 26. doi: 10.1038/s41586-026-10156-9. 10.1038/s41586-026-10156-9 PubMed 41588170