pAAV-UbC-CytoTape-HaloTag
(Plasmid
#239616)
-
PurposeCytoTape timestamp monomer (HaloTag fused to CytoTape-HA) for encoding time along the CytoTape fiber for cell culture applications.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-UbC
-
Backbone manufacturerEpoch Life Science, Inc.
- Backbone size w/o insert (bp) -3
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytoTape-Halotag
-
SpeciesSynthetic
- Promoter UbC promoter
-
Tag
/ Fusion Protein
- Halotag-dMBP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCGCAGATCGATAACTAGTGC
- 3′ sequencing primer GCAAACAACAGATGGCTGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.10.653182 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-UbC-CytoTape-HaloTag was a gift from Changyang Linghu (Addgene plasmid # 239616 ; http://n2t.net/addgene:239616 ; RRID:Addgene_239616) -
For your References section:
Scalable and multiplexed recorders of gene regulation dynamics across weeks. Zheng L, Shi D, Yan Y, Zhou B, Lim J, Hou Y, An B, Adhinarta JK, Lin M, Ko B, Joesten WC, Gautam M, Huez EDM, Kim EC, Klyder EG, Chang B, Pitchiaya S, Roberts MT, Cai DJ, Boyden ES, Wei D, Lio P, Linghu C. Nature. 2026 Jan 26. doi: 10.1038/s41586-026-10156-9. 10.1038/s41586-026-10156-9 PubMed 41588170