Skip to main content

pStUbi7::FLS2XL-EGFP
(Plasmid #239620)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239620 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGWB404
  • Total vector size (bp) 15393
  • Modifications to backbone
    Added potato StUbi7 promoter and monomer
  • Vector type
    Plant Expression
  • Selectable markers
    nptII

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FLS2XL
  • Species
    Vitis riparia
  • Insert Size (bp)
    3496
  • GenBank ID
    PQ283347
  • Promoter StUbi7
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (unknown if destroyed)
  • 3′ cloning site Spe1 (unknown if destroyed)
  • 5′ sequencing primer CAGATATTTGTGAAAACTCTCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Georg Felix

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pStUbi7::FLS2XL-EGFP was a gift from Gitta Coaker (Addgene plasmid # 239620 ; http://n2t.net/addgene:239620 ; RRID:Addgene_239620)
  • For your References section:

    Introducing Pattern Recognition Receptors in Potato Confers Enhanced Resistance to Ralstonia solanacearum but Not a Vector Borne Pathogen. Li T, Meira FS, Jarquin Bolanos E, Guel B, Padilla CS, Mandadi KK, Thomson JG, Ranf S, Coaker G. Plant Biotechnol J. 2025 Dec;23(12):5616-5618. doi: 10.1111/pbi.70268. Epub 2025 Aug 19. 10.1111/pbi.70268 PubMed 41319050