CaMK2rep-S603A
(Plasmid
#239623)
-
PurposeInactive CaMKII activity reporter. The plasmid contains sGFP2 fluorescent protein, 3xmyc tags and double mutated phospho-site 3 from rat Synapsin-1a.
-
Depositing Lab
-
Depositing OrganizationUniversidad Autonoma de Madrid
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 239623-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 239623-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5481
- Total vector size (bp) 6661
-
Modifications to backboneEM7 promoter-BleoR instead of NeoR/KanR
-
Vector typeMammalian Expression
-
Selectable markersBleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpotNES-sGFP2-SynP3-3xmyc
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1236
-
Mutationchanged Serine 603 to Alanine
-
GenBank IDNM_019133.2
-
Entrez GeneSyn1
- Promoter CMV
-
Tags
/ Fusion Proteins
- Spot (N terminal on insert)
- sGFP2 (N terminal on insert)
- myc (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGACTCACGGGGATTTCCAAGTC
- 3′ sequencing primer CCCACCCCACCCCCCAGAATAGAATGACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.07.652623 for bioRxiv preprint.
Depositor confirms P89S in sGFP2, changes are not expected to impact function.
DNA (Catalog # 239623-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 239623-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CaMK2rep-S603A was a gift from F Javier Díez Guerra (Addgene plasmid # 239623 ; http://n2t.net/addgene:239623 ; RRID:Addgene_239623) -
For your References section:
CaMK2rep: A Highly Sensitive Genetically Encoded Biosensor for Monitoring CaMKII Activity in Mammalian Cells. Martinez-Blanco E, de Andres R, Baratas-Alvarez L, Diez-Guerra FJ. Anal Chem. 2025 Sep 23;97(37):20275-20290. doi: 10.1021/acs.analchem.5c03227. Epub 2025 Sep 14. 10.1021/acs.analchem.5c03227 PubMed 40947561