pCSCG-TM(DPP4)-Fc-hST6Gal1 WT
(Plasmid
#239826)
-
PurposeDisplays Fc-fusion hST6Gal1 WT on mammalian cell surface via transmembrane domain of DPP4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCSCG
- Backbone size w/o insert (bp) 7772
- Total vector size (bp) 9518
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTM(DPP4)-Fc-hST6Gal1 WT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1740
-
Mutationamino acids 1-89 of hST6Gal1 were deleted
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- human IgG1 Fc region (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGCATTGGTAGCTGCTGTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySriram Neelamegham (Addgene #239822)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert size includes N-terminal TM and Fc portion.
TM(DPP4)-Fc-hST6Gal1 WT shows enzymatic activity for acceptor substrates on mammalian cell surface.
Please visit https://doi.org/10.21203/rs.3.rs-5004188/v1 for the preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSCG-TM(DPP4)-Fc-hST6Gal1 WT was a gift from Sriram Neelamegham (Addgene plasmid # 239826 ; http://n2t.net/addgene:239826 ; RRID:Addgene_239826) -
For your References section:
Mammalian Cell Surface Display for High-Throughput Protein Engineering of Glycosyltransferases. Hombu R, Neelamegham S. Small. 2025 May 26:e2502318. doi: 10.1002/smll.202502318. 10.1002/smll.202502318 PubMed 40417887