Skip to main content

TPC2-mCherry
(Plasmid #240468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240468 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 240468-D50 50 μg of DNA in Tris buffer $495
DNA 240468-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA5TO
  • Backbone size w/o insert (bp) 3964
  • Total vector size (bp) 6964
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TPC2N2
  • Alt name
    TPC2, two-pore channel 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2256
  • Mutation
    Mutated aspartate 276 to lysine.
  • GenBank ID
    BC141195
  • Entrez Gene
    TPCN2 (a.k.a. SHEP10, TPC2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer gaaatttgtgatgctattgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TPC2-mCherry was a gift from Antony Galione (Addgene plasmid # 240468 ; http://n2t.net/addgene:240468 ; RRID:Addgene_240468)
  • For your References section:

    Optical profiling of autonomous Ca(2+) nanodomains generated by lysosomal TPC2 and TRPML1. Davis LC, Morgan AJ, Galione A. Cell Calcium. 2023 Dec;116:102801. doi: 10.1016/j.ceca.2023.102801. Epub 2023 Sep 18. 10.1016/j.ceca.2023.102801 PubMed 37742482