Skip to main content

pFN18a-HaloTag-SpyCatcher
(Plasmid #240511)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240511 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pFN18A HaloTag T7
  • Backbone manufacturer
    Promega Corporation
  • Backbone size w/o insert (bp) 3058
  • Total vector size (bp) 4397
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag-SpyCatcher
  • Species
    Synthetic
  • Tags / Fusion Proteins
    • HaloTag (N terminal on backbone)
    • SpyCatcher (C terminal on insert)
    • HisTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer ATGGCAGAAATCGGTACTGGCTTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFN18a-HaloTag-SpyCatcher was a gift from Ionel Popa (Addgene plasmid # 240511 ; http://n2t.net/addgene:240511 ; RRID:Addgene_240511)
  • For your References section:

    The Influence of DNA Handles on the Mechanical Response of Single Protein Molecules. Sharma S, Rahman S, Becker MZ, Pelah MG, Berkovich R, Popa I. Biomacromolecules. 2025 May 13. doi: 10.1021/acs.biomac.5c00429. 10.1021/acs.biomac.5c00429 PubMed 40359487