pFN18a-HaloTag-(protein L)8-SpyTag
(Plasmid
#240512)
-
PurposeBacterial expression of HaloTag-(protein L)8-SpyTag-HisTag-Cys used as calibration standard for magnetic tweezers
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFN18A HaloTag T7
-
Backbone manufacturerPromega Corporation
- Backbone size w/o insert (bp) 3058
- Total vector size (bp) 5615
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeight repeats of B1 domain of Protein L located between HaloTag and SpyTag
-
SpeciesFinegoldia magna
-
Insert Size (bp)1611
-
GenBank ID
-
Tags
/ Fusion Proteins
- HaloTag (N terminal on backbone)
- SpyTag (C terminal on insert)
- HisTag (C terminal on insert)
- Cysteine (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer ATGGCAGAAATCGGTACTGGCTTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFN18a-HaloTag-(protein L)8-SpyTag was a gift from Ionel Popa (Addgene plasmid # 240512 ; http://n2t.net/addgene:240512 ; RRID:Addgene_240512) -
For your References section:
The Influence of DNA Handles on the Mechanical Response of Single Protein Molecules. Sharma S, Rahman S, Becker MZ, Pelah MG, Berkovich R, Popa I. Biomacromolecules. 2025 May 13. doi: 10.1021/acs.biomac.5c00429. 10.1021/acs.biomac.5c00429 PubMed 40359487