mU6-sgRNA-CLTA-mCherry
(Plasmid
#240637)
-
PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and mCherry from the EF1Alpha promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 240637-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 240637-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSICO derivative
- Backbone size w/o insert (bp) 3996
- Total vector size (bp) 5499
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepuro-T2A-mCherry
-
gRNA/shRNA sequenceCTGTGGTGCCGACTGGGAGC
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 240637-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 240637-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mU6-sgRNA-CLTA-mCherry was a gift from James Nuñez (Addgene plasmid # 240637 ; http://n2t.net/addgene:240637 ; RRID:Addgene_240637) -
For your References section:
Programmable epigenome editing by transient delivery of CRISPR epigenome editor ribonucleoproteins. Xu D, Besselink S, Ramadoss GN, Dierks PH, Lubin JP, Pattali RK, Brim JI, Christenson AE, Colias PJ, Ornelas IJ, Nguyen CD, Chasins SE, Conklin BR, Nunez JK. Nat Commun. 2025 Aug 26;16(1):7948. doi: 10.1038/s41467-025-63167-x. 10.1038/s41467-025-63167-x PubMed 40858609