Skip to main content

pCR241
(Plasmid #240644)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 240644 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pT2HE
  • Backbone manufacturer
    Tim Howes
  • Backbone size w/o insert (bp) 3366
  • Total vector size (bp) 6440
  • Modifications to backbone
    Complete rearrangement of the elements of the backbone during Gibson Assembly to include oriR and AmpR within Tol2 flanks.
  • Vector type
    Gene expression and genomic integration in fish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AIPGENE865 promoter
  • Species
    Exaiptasia diaphana
  • Insert Size (bp)
    1810
  • Mutation
    naturally occurring 749-bp insertion at bp 628 (from bp 1 of plasmid map), corrected exon/intron positions (in agreement with XM_021048156.2).
  • GenBank ID
    KXJ12416.1 XM_021048156.2

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Tol2right_up_seq_fwd (CTGTTCAGACACCCATATCC), P1_fwd (CGTACGCTAGCGATATCGG)
  • 3′ sequencing primer P2A_seq_rev (AGGACCGGGGTTTTCTTCC)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SP6 promoter
  • Insert Size (bp)
    19

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    AmNeonGreen
  • Species
    Synthetic
  • Insert Size (bp)
    708
  • Mutation
    Codon-optimized for Exaiptasia diaphana, amino acid sequence identical to original mNeonGreen.
  • GenBank ID
    KC295282.1
  • Tag / Fusion Protein
    • 13myc (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Pag865end_seq_fwd (AAGCGAATTGTGACATTCGTTG)
  • 3′ sequencing primer AmNG_end-49_fwd (AAGCGAATTGTGACATTCGTTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pT2HE (backbone): O’Brown NM, Summers BR, Jones FC, Brady SD, Kingsley DM. 2015. A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA. eLife. 4:e05290. doi:10.7554/eLife.05290. mNeonGreen: Shaner NC, Lambert GG, Chammas A, Ni Y, Cranfill PJ, Baird MA, Sell BR, Allen JR, Day RN, Israelsson M, et al. 2013. A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum. Nat Methods. 10(5):407–409. doi:10.1038/nmeth.2413. pFA6a-13myc-KanMX6 (source of 13myc tag; Addgene plasmid #39294): Longtine MS, Mckenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 14(10):953–961. doi:10.1002/(SICI)1097-0061(199807)14:10<953::AID-YEA293>3.0.CO;2-U.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The whole intergenic region between AIPGENE865 (KXJ12416.1; Elongation Factor 1alpha) and AIPGENE899 was cloned as promoter fragment. The original gene annotation for AIPGENE865 is incorrect, the automatic NCBI annotation is correct in regards of exons, introns and translation start site. We found that Aiptasia strain CC7 was actually heterozygous for that locus: one allele was mostly in agreement with the genome sources but the other one had a couple of SNPs and a large, 749-bp insert in the intergenic region. The longer version with insert was used as promoter for this plasmid.

AmNeonGreen is a version of mNeonGreen codon-optimized for Aiptasia (based on the transcriptome of Lehnert et al., 2014) with the identical protein sequence.

Lehnert EM, Mouchka ME, Burriesci MS, Gallo ND, Schwarz JA, Pringle JR. 2014. Extensive differences in gene expression between symbiotic and aposymbiotic cnidarians. G3 Bethesda Md. 4(2):277–295. doi:10.1534/g3.113.009084.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR241 was a gift from John Pringle (Addgene plasmid # 240644 ; http://n2t.net/addgene:240644 ; RRID:Addgene_240644)