pTT3_10-1074_NHP_IgG
(Plasmid
#241007)
-
PurposeExpresses full-length 10-1074
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTT3
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5934
- Total vector size (bp) 8318
-
Vector typeMammalian Expression, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name10-1074
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2384
- Promoter CMV
-
Tag
/ Fusion Protein
- 6x-His Avi-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGCAGTGTTCGTCAGCCCTTCCGCTAGCAGCTACGTTCGACCTCTCAG
- 3′ sequencing primer agggaatacactcgggcccttggtgctagcGCTGCTCACTGTGACAGTAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.02.651933 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT3_10-1074_NHP_IgG was a gift from Jennifer Adair (Addgene plasmid # 241007 ; http://n2t.net/addgene:241007 ; RRID:Addgene_241007) -
For your References section:
In vivo production of an anti-HIV antibody in mice by non-viral gene knock-in in primate hematopoietic stem and progenitor cells. Castelli JMP, Poljakov K, Jwa Y, Cunningham R, Cassidy ME, Gray MD, Sanchez Gaytan JN, Enstrom MR, Gastelum G, Wang Z, Linton JD, Rongvaux A, Taylor JJ, Adair JE. Mol Ther. 2026 Feb 2:S1525-0016(26)00081-X. doi: 10.1016/j.ymthe.2026.01.038. 10.1016/j.ymthe.2026.01.038 PubMed 41635086