longVGLL3-GFP
(Plasmid
#241149)
-
Purposeexpresses long isoform of VGLL3 tagged by GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDP011
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7522
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelongVGLL3-GFP
-
SpeciesN. furzeri
-
Insert Size (bp)1899
-
Entrez Genevgll3
- Promoter ef1a
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCATTGATCCACCTCCACCGAACCAGACTGGAGTCTTCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
longVGLL3-GFP was a gift from Itamar Harel (Addgene plasmid # 241149 ; http://n2t.net/addgene:241149 ; RRID:Addgene_241149) -
For your References section:
An antagonistically pleiotropic gene regulates vertebrate growth, maturity, and lifespan. Moses E, Bergman M, Atlan T, Duxbury EML, Franek R, Ben Dor O, von Chrzanowski H, Abu-Zhayia ER, Ayoub N, Kinreich S, Ben-Ami I, Maklakov AA, Harel I. Nat Commun. 2026 Jun 2;17(1):4410. doi: 10.1038/s41467-026-72381-0. 10.1038/s41467-026-72381-0 PubMed 42230577