pLentiLox7.0-CAGEc-RFP (Nrdj1)
(Plasmid
#241402)
-
PurposeProximity-triggered Protein Trans-Splicing between mVenus and RFP, Figure 1 in Nature Chemical Biology 20.10 (2024): 1353-1360.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLentiLox7.0
- Backbone size w/o insert (bp) 6958
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAGEc-RFP (Nrdj1)
-
SpeciesSynthetic
-
Insert Size (bp)1386
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Engineered NrdJ-1C intein (Caged NrdJ-1C) fused to the 5'-end of RFP. FRB domain used to the 5'-end of Caged NrdJ-1C.
Please note: This plasmid lacks a 5' LTR and cannot be used to create stable cell lines by lentiviral transduction. In the original publication, the plasmid was used for transient transfection. Therefore, this sequence conflict does not impact the conclusions of the publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiLox7.0-CAGEc-RFP (Nrdj1) was a gift from Thomas Muir (Addgene plasmid # 241402 ; http://n2t.net/addgene:241402 ; RRID:Addgene_241402) -
For your References section:
Distinct phases of cellular signaling revealed by time-resolved protein synthesis. Lee G, Muir TW. Nat Chem Biol. 2024 Oct;20(10):1353-1360. doi: 10.1038/s41589-024-01677-3. Epub 2024 Jul 8. 10.1038/s41589-024-01677-3 PubMed 38977789