pLentiLox7.0-mVenus-CAGEn-Caax (Nrdj1)
(Plasmid
#241405)
-
PurposeProximity-triggered Protein Trans-Splicing between mVenus and RFP, Figure 1 in Nature Chemical Biology 20.10 (2024): 1353-1360.
-
Depositing Lab
-
Depositing OrganizationPrinceton University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLentiLox7.0
- Backbone size w/o insert (bp) 6958
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus-CAGEn-Caax (Nrdj1)
-
SpeciesSynthetic
-
Insert Size (bp)1719
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Engineered NrdJ-1N intein (Caged NrdJ-1N) fused to the 3'-end of mVenus-add-on sequence (NPC). FKBP*domain and Caax motif fused to the 3'-end of Caged NrdJ-1N.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiLox7.0-mVenus-CAGEn-Caax (Nrdj1) was a gift from Thomas Muir (Addgene plasmid # 241405 ; http://n2t.net/addgene:241405 ; RRID:Addgene_241405) -
For your References section:
Distinct phases of cellular signaling revealed by time-resolved protein synthesis. Lee G, Muir TW. Nat Chem Biol. 2024 Oct;20(10):1353-1360. doi: 10.1038/s41589-024-01677-3. Epub 2024 Jul 8. 10.1038/s41589-024-01677-3 PubMed 38977789