pLenti-PGK-GNAQ Q209P L43A/L44A sgRES
(Plasmid
#241924)
-
PurposeExpresses a GNAQ guide RNA resistant GNAQ Q209P L43A/L44A mutant protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLENTI
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAQ Q209P L43A/L44A sgRES
-
SpeciesH. sapiens (human)
-
MutationQ209P, L43A/L44A
-
Entrez GeneGNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CAA -> CCA mutation to replace the Glutamine (Q209) with Proline (Q209P), GCC -> GCA silent mutation at PAM site for sgGNAQ #3 (ATCTTGTTGCGTAGGCAGGT) to make the GNAQ cDNA resistant to sgGNAQ# 3 and CTGCTG -> GCGGCG mutation to replace the two Leucine residues (L43 and L44) with Alanine (L43A/L44A)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-GNAQ Q209P L43A/L44A sgRES was a gift from Rizwan Haq (Addgene plasmid # 241924 ; http://n2t.net/addgene:241924 ; RRID:Addgene_241924)