Skip to main content

pLenti-PGK-EGFP-GNAQ Q209P L43A/L44A sgRES
(Plasmid #241926)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241926 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLENTI
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-GNAQ Q209P L43A/L44A sgRES
  • Species
    H. sapiens (human)
  • Mutation
    Q209P, L43A/L44A
  • Entrez Gene
    GNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CAA -> CCA mutation to replace the Glutamine (Q209) with Proline (Q209P), GCC -> GCA silent mutation at PAM site for sgGNAQ #3 (ATCTTGTTGCGTAGGCAGGT) to make the GNAQ cDNA resistant to sgGNAQ# 3 and CTGCTG -> GCGGCG mutation to replace the two Leucine residues (L43 and L44) with Alanine (L43A/L44A)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-EGFP-GNAQ Q209P L43A/L44A sgRES was a gift from Rizwan Haq (Addgene plasmid # 241926 ; http://n2t.net/addgene:241926 ; RRID:Addgene_241926)