Skip to main content

LentiGuide Puro-P2A-mCherry-sgAP3S1 #3
(Plasmid #241930)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241930 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiGuide
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgAP3S1 #3
  • gRNA/shRNA sequence
    TCAACAACCACGGGAAGCCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    AP3S1 (a.k.a. CLAPS3, Sigma3A)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide Puro-P2A-mCherry-sgAP3S1 #3 was a gift from Rizwan Haq (Addgene plasmid # 241930 ; http://n2t.net/addgene:241930 ; RRID:Addgene_241930)
  • For your References section:

    Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388