LentiGuide Puro-P2A-BFP-sgAP3S2 #6
(Plasmid
#241932)
-
PurposeExpresses BFP and an sgRNA targetting human AP3S2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiGuide
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgAP3S2 #6
-
gRNA/shRNA sequenceTGGGAAGCCACGGCTAGTCC
-
SpeciesH. sapiens (human)
-
Entrez GeneAP3S2 (a.k.a. AP3S3, sigma3b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuide Puro-P2A-BFP-sgAP3S2 #6 was a gift from Rizwan Haq (Addgene plasmid # 241932 ; http://n2t.net/addgene:241932 ; RRID:Addgene_241932)