LentiCRISPR V2-sgAP3S1 #4
(Plasmid
#241940)
-
PurposeExpresses an sgRNA targetting human AP3S1
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPR V2
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgAP3S1 #4
-
gRNA/shRNA sequenceCTTGCAGAAATGGTGATGGG
-
SpeciesH. sapiens (human)
-
Entrez GeneAP3S1 (a.k.a. CLAPS3, Sigma3A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR V2-sgAP3S1 #4 was a gift from Rizwan Haq (Addgene plasmid # 241940 ; http://n2t.net/addgene:241940 ; RRID:Addgene_241940) -
For your References section:
Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388