LentiCRISPR V2-sgGNAQ #1
(Plasmid
#241942)
-
PurposeExpresses an sgRNA targetting human GNAQ
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLENTI
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgGNAQ #1
-
gRNA/shRNA sequenceAAGTATGAGCACAATAAGGT
-
SpeciesH. sapiens (human)
-
Entrez GeneGNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR V2-sgGNAQ #1 was a gift from Rizwan Haq (Addgene plasmid # 241942 ; http://n2t.net/addgene:241942 ; RRID:Addgene_241942)