Skip to main content

pLenti-PGK-AP3S2 sgRES
(Plasmid #241947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241947 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLENTI
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AP3S2 sgRES
  • Species
    H. sapiens (human)
  • Mutation
    sgRES
  • Entrez Gene
    AP3S2 (a.k.a. AP3S3, sigma3b)

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CGG -> CGT silent mutation at PAM site for sgAP3S2# 2 (TCAACAACCATGGGAAGCCA) and sgAP3S1 #3 (TCAACAACCACGGGAAGCCG) to make the AP3S2 cDNA resistant to sgAP3S2 #2 and sgAP3S1# 3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-PGK-AP3S2 sgRES was a gift from Rizwan Haq (Addgene plasmid # 241947 ; http://n2t.net/addgene:241947 ; RRID:Addgene_241947)