Skip to main content

pDONR-GNAQ WT L43A/L44A sgRES CLOSED
(Plasmid #241953)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 241953 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDONR
  • Vector type
    Gateway Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GNAQ WT L43A/L44A sgRES
  • Species
    H. sapiens (human)
  • Mutation
    sgRES, L43A/L44A
  • Entrez Gene
    GNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GCC -> GCA silent mutation at PAM site for sgGNAQ #3 (ATCTTGTTGCGTAGGCAGGT) to make the GNAQ cDNA resistant to sgGNAQ# 3 and CTGCTG -> GCGGCG mutation to replace the two Leucine residues (L43 and L44) with Alanine (L43A/L44A)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR-GNAQ WT L43A/L44A sgRES CLOSED was a gift from Rizwan Haq (Addgene plasmid # 241953 ; http://n2t.net/addgene:241953 ; RRID:Addgene_241953)
  • For your References section:

    Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388