pDONR-EGFP-GNAQ Q209P L43A/L44A sgRES CLOSED
(Plasmid
#241956)
-
PurposeGateway entry vector containing GFP-GNAQ Q209P L43A/L44A sgRES
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-GNAQ Q209P L43A/L44A sgRES
-
SpeciesH. sapiens (human)
-
MutationQ209P, sgRES, L43A/L44A
-
Entrez GeneGNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CAA -> CCA mutation to replace the Glutamine (Q209) with Proline (Q209P), GCC -> GCA silent mutation at PAM site for sgGNAQ #3 (ATCTTGTTGCGTAGGCAGGT) to make the GNAQ cDNA resistant to sgGNAQ# 3 and CTGCTG -> GCGGCG mutation to replace the two Leucine residues (L43 and L44) with Alanine (L43A/L44A)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR-EGFP-GNAQ Q209P L43A/L44A sgRES CLOSED was a gift from Rizwan Haq (Addgene plasmid # 241956 ; http://n2t.net/addgene:241956 ; RRID:Addgene_241956) -
For your References section:
Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388