pDONR-AP3S1 sgRES CLOSED
(Plasmid
#241958)
-
PurposeGateway entry vector containing AP3S1 sgRES
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAP3S1 sgRES
-
SpeciesH. sapiens (human)
-
MutationsgRES
-
Entrez GeneAP3S1 (a.k.a. CLAPS3, Sigma3A)
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CGG -> CGA silent mutation at PAM site for sgAP3S1 #3 (TCAACAACCACGGGAAGCCG) to make the AP3S1 cDNA resistant to sgAP3S1# 3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR-AP3S1 sgRES CLOSED was a gift from Rizwan Haq (Addgene plasmid # 241958 ; http://n2t.net/addgene:241958 ; RRID:Addgene_241958) -
For your References section:
Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388