pDONR-GNAQ Q209P sgRES OPEN
(Plasmid
#241966)
-
PurposeGateway entry vector containing GNAQ Q209P sgRES
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 241966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAQ Q209P sgRES
-
gRNA/shRNA sequenceUnspecified
-
SpeciesH. sapiens (human)
-
MutationQ209P, sgRES
-
Entrez GeneGNAQ (a.k.a. CMAL, CMC1, G-ALPHA-q, GAQ, SWS)
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CAA -> CCA mutation to replace the Glutamine (Q209) with Proline (Q209P) and GCC -> GCA silent mutation at PAM site for sgGNAQ #3 (ATCTTGTTGCGTAGGCAGGT) to make the GNAQ cDNA resistant to sgGNAQ# 3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR-GNAQ Q209P sgRES OPEN was a gift from Rizwan Haq (Addgene plasmid # 241966 ; http://n2t.net/addgene:241966 ; RRID:Addgene_241966) -
For your References section:
Oncogenic Galpha signaling requires AP-3-dependent recruitment to the endolysosomal compartment. Shettigar M, Mouliere S, Isenegger L, DeVine AL, Gstalder C, Koduri V, Doench JG, Ksander B, Garcia-Marcos M, Kaelin WG Jr, Haq R. Proc Natl Acad Sci U S A. 2026 Jul 28;123(30):e2615774123. doi: 10.1073/pnas.2615774123. Epub 2026 Jul 22. 10.1073/pnas.2615774123 PubMed 42485388