pAAV-SYN1>Fas-Myc/Kir2.1*(E224G Y242F):P2A :dTomato
(Plasmid
#242233)
-
PurposeExpress Kir 2.1 and dTomato in the neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePAAV-Syn
-
Vector typeMammalian Expression, AAV, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFas
-
Insert Size (bp)34
- Promoter SYN
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer aacttcgtatatacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMyc/Kir2.1 (E224GY242F)
-
SpeciesSynthetic
-
Insert Size (bp)1314
- Promoter SYN
Cloning Information for Gene/Insert 2
- Cloning method Gene Synthesis
- 5′ sequencing primer agaagctgatcagcgaggagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SYN1>Fas-Myc/Kir2.1*(E224G Y242F):P2A :dTomato was a gift from Qingchun Tong (Addgene plasmid # 242233 ; http://n2t.net/addgene:242233 ; RRID:Addgene_242233) -
For your References section:
An alternative neural basis underlying leptin resistance. Li H, Su C, Xu Y, Ludwig MQ, Davis J, Tong Q. Cell Rep. 2025 Jun 19;44(7):115863. doi: 10.1016/j.celrep.2025.115863. 10.1016/j.celrep.2025.115863 PubMed 40540394