pFastBac1-His-MuSK-homo-wt-530-869
(Plasmid
#242442)
-
PurposeProtein expression construct for use with Bac-to-Bac
-
Depositing Lab
-
Depositing OrganizationYale University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4816
- Total vector size (bp) 5839
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBac-to-bac system
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMuscle specific kinase JM and TKD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1023
-
Mutationaa 530-869 only
-
GenBank IDNM_005592
-
Entrez GeneMUSK (a.k.a. CMS9, FADS, FADS1)
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- 6xHis tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGATTATTCATACCGTCCCACCATCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byI.M.A.G.E. consortium. See Strausberg et al (2002) Mammalian Gene Collection Program Team. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. doi: 10.1073/pnas.242603899. PMID: 12477932; PMCID: PMC139241.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1-His-MuSK-homo-wt-530-869 was a gift from Mark Lemmon (Addgene plasmid # 242442 ; http://n2t.net/addgene:242442 ; RRID:Addgene_242442) -
For your References section:
An S752D activation loop mutation dynamically primes Muscle-Specific Kinase for activation. Promer JJ, Murphy JW, Lemmon MA, Tsutsui Y, Herbst R. Biochem J. 2026 Jul 8;483(7):1221-1235. doi: 10.1042/BCJ20260159. 10.1042/BCJ20260159 PubMed 42240394