pKMM020
(Plasmid
#242508)
-
PurposeDerivative of pALC929 with a mutation (#3) in the RBS of OphK.
-
Depositing Lab
-
Depositing OrganizationNational Laboratory of the Rockies (NLR)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242508 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepK18mobsacB
-
Backbone manufacturerATCC® 87097
- Backbone size w/o insert (bp) 5330
- Total vector size (bp) 10978
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameUpstream homology arm
-
SpeciesPseudomonas putida KT2440
-
Insert Size (bp)725
Gene/Insert 2
-
Gene/Insert nameOphC_AG8816
-
SpeciesStutzerimonas stutzeri KGS-2
-
Insert Size (bp)993
- Promoter tac
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACAATCAACGCGAGCGTTAGGAAGCATAAAGTGTAAAGTCGACGTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameOphC2_AG8816
-
SpeciesStutzerimonas stutzeri KGS-2
-
Insert Size (bp)849
Gene/Insert 4
-
Gene/Insert nameOphK_AG8816
-
SpeciesStutzerimonas stutzeri KGS-2
-
Insert Size (bp)1356
- Promoter Ptac
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer cacacaggagggAatcatatgacgactacagcc
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameDownstream homology arm
-
SpeciesPseudomonas putida KT2440
-
Insert Size (bp)777
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKMM020 was a gift from Gregg Beckham (Addgene plasmid # 242508 ; http://n2t.net/addgene:242508 ; RRID:Addgene_242508) -
For your References section:
Lignin to adipic acid in a high-yield chemical and biological redox process. Mains KM, Palumbo CT, Rigo D, Webber MS, Rosetto G, Bao ST, Carroll AL, Meyer NR, Benson AF, Boyle BA, Haugen SJ, Ingraham MA, Alexander WG, Silberman M, Myers LC, Ramirez KJ, Sullivan KP, Guss AM, Salvachua D, Roman-Leshkov Y, Stahl SS, Werner AZ, Beckham GT. Nature. 2026 Jun;654(8119):668-675. doi: 10.1038/s41586-026-10580-x. Epub 2026 Jun 10. 10.1038/s41586-026-10580-x PubMed 42271049