pcDNA3.1-Ecad-A592T-YFP
(Plasmid
#242761)
-
PurposeE-cadherin A592T mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE-cadherin A592T
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATTAATCCGGACACTGGTGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Ecad-A592T-YFP was a gift from Deborah Leckband (Addgene plasmid # 242761 ; http://n2t.net/addgene:242761 ; RRID:Addgene_242761) -
For your References section:
Epidermal growth factor receptor is an essential component in E-cadherin force transduction complexes. Zou Y, Allen N, Rauf E, Leckband D. J Cell Sci. 2025 Nov 1;138(21):jcs264350. doi: 10.1242/jcs.264350. Epub 2025 Nov 13. 10.1242/jcs.264350 PubMed 40908853