Skip to main content
Addgene
Open Menu

pMXs-IRES-Blast-3xFLAG-GFP-SLC45A1 mutant p.Arg210Trp
(Plasmid #242979)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 242979 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pMXs-IRES-Blast-3xFLAG-GFP
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC45A1
  • Species
    H. sapiens (human)
  • Mutation
    Changed Arginine 210 to Tryptophan
  • GenBank ID
    NM_001080397.2
  • Entrez Gene
    SLC45A1 (a.k.a. DNB5, IDDNPF, PAST-A)
  • Tag / Fusion Protein
    • FLAG-GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catctccccaatcctgggctttc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Codon-optimized SLC45A1 orf was amplified from pDONR221_SLC45A1 plasmid (Addgene Plasmid #132289)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IRES-Blast-3xFLAG-GFP-SLC45A1 mutant p.Arg210Trp was a gift from Monther Abu-Remaileh (Addgene plasmid # 242979 ; http://n2t.net/addgene:242979 ; RRID:Addgene_242979)

  • For your References section:

    Cell-type resolved protein atlas of brain lysosomes identifies SLC45A1-associated disease as a lysosomal disorder. Ghoochani A, Heiby JC, Rawat ES, Medoh UN, Di Fraia D, Dong W, Gastou M, Rastogi M, Hernandez V, Nyame K, Laqtom NN, Durso W, Valkova C, Isakova A, Kaether C, Wernig M, Gomez-Ospina N, Franke C, Ori A, Abu-Remaileh M. Cell. 2026 Feb 5;189(3):765-782.e31. doi: 10.1016/j.cell.2025.12.012. Epub 2026 Jan 22. 10.1016/j.cell.2025.12.012 PubMed 41576950
Related items: