pMXs-IRES-Blast-3xFLAG-GFP-SLC45A1 mutant p.Arg210Trp
(Plasmid
#242979)
-
PurposeSLC45A1 mutant p.Arg210Trp codon-optimized orf with n-terminal 3xFlag and GFP in pMXs-IRES-Blast vector
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 242979 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs-IRES-Blast-3xFLAG-GFP
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC45A1
-
SpeciesH. sapiens (human)
-
MutationChanged Arginine 210 to Tryptophan
-
GenBank IDNM_001080397.2
-
Entrez GeneSLC45A1 (a.k.a. DNB5, IDDNPF, PAST-A)
-
Tag
/ Fusion Protein
- FLAG-GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catctccccaatcctgggctttc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCodon-optimized SLC45A1 orf was amplified from pDONR221_SLC45A1 plasmid (Addgene Plasmid #132289)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IRES-Blast-3xFLAG-GFP-SLC45A1 mutant p.Arg210Trp was a gift from Monther Abu-Remaileh (Addgene plasmid # 242979 ; http://n2t.net/addgene:242979 ; RRID:Addgene_242979) -
For your References section:
Cell-type resolved protein atlas of brain lysosomes identifies SLC45A1-associated disease as a lysosomal disorder. Ghoochani A, Heiby JC, Rawat ES, Medoh UN, Di Fraia D, Dong W, Gastou M, Rastogi M, Hernandez V, Nyame K, Laqtom NN, Durso W, Valkova C, Isakova A, Kaether C, Wernig M, Gomez-Ospina N, Franke C, Ori A, Abu-Remaileh M. Cell. 2026 Feb 5;189(3):765-782.e31. doi: 10.1016/j.cell.2025.12.012. Epub 2026 Jan 22. 10.1016/j.cell.2025.12.012 PubMed 41576950