pQCXIP-TfR-EGFP
(Plasmid #243763)

• Purpose: Mammalian expression vector encoding a protein fusion composed of human transferrin receptor (TFRC) followed by EGFP
• Depositing Labs: Dominik Buser, Martin Spiess
• Publication: Buser et al J Vis Exp. 2025 Oct 17;(224). doi: 10.3791/69284.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: Clontech/Takara Bio
• Backbone size w/o insert (bp): 7181
• Total vector size (bp): 8709
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TfR
• Alt name: Transferrin receptor
• Species: H. sapiens (human)
• Insert Size (bp): 2073
• Entrez Gene: TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: ACGCCATCCACGCTGTTTTGACCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the depositor's annotated reference file has several differences compared to the Addgene verified sequence. The depositing lab confirms that the differences in the ‘Extended packaging signal’ feature and other minor backbone changes do not alter the plasmid's function. Please refer to the the Addgene sequence for the most accurate result.