pCAG_Venus
(Plasmid
#244250)
-
PurposeExpresses venus under the CAG promoter
-
Depositing Lab
-
Depositing OrganizationYale University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 244250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG vector
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 5600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank IDXCW89625.1
- Promoter pCAG
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer tcgagctagccaccatggtgag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG_Venus was a gift from Tristan Geiller (Addgene plasmid # 244250 ; http://n2t.net/addgene:244250 ; RRID:Addgene_244250)