pATUBR
(Plasmid
#245488)
-
PurposeBinary Plasmid for plant transformation expressing RUBY from the Arabidopsis thaliana polyubiquitin 10 gene promoter and the terminator from the pea RBCS gene. Kanamycin plant selection
-
Depositing Lab
-
Depositing OrganizationOregon State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAGM4273
- Backbone size w/o insert (bp) 12773
- Total vector size (bp) 12236
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepAtUBI-RUBY-tRBCS
-
Insert Size (bp)6117
- Promoter Polyubiquitin 10 gene from Arabidopsis thaliana
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer gacgtcgttgtggttggtgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATUBR was a gift from Beth Rowan (Addgene plasmid # 245488 ; http://n2t.net/addgene:245488 ; RRID:Addgene_245488)