pICSL50044
(Plasmid
#245602)
-
PurposeLevel 0 Golden Gate part C-Terminal Tag with overhangs TTCG - GCTT
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICSL01003
- Backbone size w/o insert (bp) 2244
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-Terminal tag Monomeric eGFP (mEGFP)
-
SpeciesAequorea victoria
-
Insert Size (bp)721
-
MutationBsaI/BpiI sites removed by point-mutation
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TCACATGTTCTTTCCTGCG
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Level 0 C-Terminal tag module used for GoldenGate assemblies using the MoClo overhang syntax
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL50044 was a gift from Mark Youles (Addgene plasmid # 245602 ; http://n2t.net/addgene:245602 ; RRID:Addgene_245602)