pYPQ131-FCY-UPP
(Plasmid
#245873)
-
PurposeGolden gate entry vector carrying expression cassette for genes FCY and UPP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHD1
-
Backbone manufacturerCermak et al. 2011
- Total vector size (bp) 5038
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFCY1-UPP
-
SpeciesSynthetic
-
Insert Size (bp)1094
- Promoter AtUBQ10
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer attactcttcgatttgtgattt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYPQ131-FCY-UPP was a gift from Yiping Qi (Addgene plasmid # 245873 ; http://n2t.net/addgene:245873 ; RRID:Addgene_245873) -
For your References section:
Transgene-free genome editing in citrus and poplar trees using positive and negative selection markers. Rocha DC, Omoregbee MO, Contiliani DF, Mandlik R, Li G, Mascoveto J, Coleman G, Culver JN, Leal DR, de Souza AA, Qi Y. Plant Cell Rep. 2025 Oct 22;44(11):244. doi: 10.1007/s00299-025-03627-2. 10.1007/s00299-025-03627-2 PubMed 41123679