huCof WT SSR RedTrack
(Plasmid
#245955)
-
PurposeExpression of WT coifilin resistant to shRNA in cells coexpressing mRFP
-
Depositing Lab
-
Depositing OrganizationColorado State University, Fort Collins
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneRedTrack CMV
-
Backbone manufacturerJames Bamburg (Addgene #50957)
- Backbone size w/o insert (bp) 9081
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecofilin 1 (cfl1)
-
SpeciesH. sapiens (human)
-
Mutationsilent mutations (NTs 67 to 75) in which TCTTCAACG is replaced with AGCTCAACC and NTs 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
-
Entrez GeneCFL1 (a.k.a. CFL, HEL-S-15, cofilin)
- Promoter CMV for huCof WT and separate CMV for mRFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
- 3′ cloning site Unspecified (unknown if destroyed)
- 5′ sequencing primer Unspecified
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The silent mutations protect expression against two human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) that target different sequences in cofilin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
huCof WT SSR RedTrack was a gift from James Bamburg (Addgene plasmid # 245955 ; http://n2t.net/addgene:245955 ; RRID:Addgene_245955)