huCof WT + rat cof shRNA
(Plasmid
#245961)
-
PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of WT human cofilin
-
Depositing Lab
-
Depositing OrganizationColorado State University, Fort Collins
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepShuttle NSE
- Backbone size w/o insert (bp) 7981
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecofilin 1 (cfl1)
-
gRNA/shRNA sequenceAAGGTGTTCAATGACATGAAA
-
SpeciesH. sapiens (human)
-
Entrez GeneCFL1 (a.k.a. CFL, HEL-S-15, cofilin)
- Promoter Neuronal Specific Enolase (NSE) for cofilin and pol III for shRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression of human cofilin is neuronal specific.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
huCof WT + rat cof shRNA was a gift from James Bamburg (Addgene plasmid # 245961 ; http://n2t.net/addgene:245961 ; RRID:Addgene_245961)