pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA
(Plasmid #246243)

• Purpose: Cre dependent flag-tagged Rpl22l1.
• Depositing Lab: D. James Surmeier
• Publication: Tanimura et al Neuron. 2019 Feb 6;101(3):444-458.e6. doi: 10.1016/j.neuron.2018.12.004. Epub 2019 Jan 15.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pFB
• Backbone manufacturer: Virovek
• Backbone size w/o insert (bp): 4533
• Total vector size (bp): 9221
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rpl22l1
• Alt name: Ribosomal protein L22-like1
• Species: M. musculus (mouse)
• Insert Size (bp): 4688
• GenBank ID: NM_001347226.3
• Entrez Gene: Rpl22l1 (a.k.a. 3110001N18Rik)
• Promoter: EF1a
• Tag / Fusion Protein:
  • Myc-FLAG-T2A-tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CCAGCTTGGTTCCCAATAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry