Skip to main content

pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA
(Plasmid #246243)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246243 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pFB
  • Backbone manufacturer
    Virovek
  • Backbone size w/o insert (bp) 4533
  • Total vector size (bp) 9221
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rpl22l1
  • Alt name
    Ribosomal protein L22-like1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4688
  • GenBank ID
    NM_001347226.3
  • Entrez Gene
    Rpl22l1 (a.k.a. 3110001N18Rik)
  • Promoter EF1a
  • Tag / Fusion Protein
    • Myc-FLAG-T2A-tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-EF1a-DIO-Rpl22l1-myc-Flag-2A-tdTomato-WPRE-hGHpA was a gift from D. James Surmeier (Addgene plasmid # 246243 ; http://n2t.net/addgene:246243 ; RRID:Addgene_246243)
  • For your References section:

    Cholinergic Interneurons Amplify Thalamostriatal Excitation of Striatal Indirect Pathway Neurons in Parkinson's Disease Models. Tanimura A, Du Y, Kondapalli J, Wokosin DL, Surmeier DJ. Neuron. 2019 Feb 6;101(3):444-458.e6. doi: 10.1016/j.neuron.2018.12.004. Epub 2019 Jan 15. 10.1016/j.neuron.2018.12.004 PubMed 30658860