Skip to main content

pX459-Dvl2 gRNA
(Plasmid #246556)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246556 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 246556-D50 50 μg of DNA in Tris buffer $495
DNA 246556-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX459
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dvl2 gRNA
  • gRNA/shRNA sequence
    TGAGGCGAGACCGACCTAGG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Dvl2
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic oligo

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CBh-SpCas9-T2A-Puro cassette on backbone

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-Dvl2 gRNA was a gift from Mario Vallon (Addgene plasmid # 246556 ; http://n2t.net/addgene:246556 ; RRID:Addgene_246556)
  • For your References section:

    WNT7A/B assemble a GPR124-RECK-LRP5/6 co-receptor complex to activate beta-catenin signaling in brain endothelial cells. Heiden R, Hannig L, Kuo CJ, Ergun S, Braunger BM, Vallon M. J Biol Chem. 2025 Sep 4:110682. doi: 10.1016/j.jbc.2025.110682. 10.1016/j.jbc.2025.110682 PubMed 40914247