pGGA-FT guide RNA1_7
(Plasmid
#246797)
-
PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAs
-
Depositing Lab
-
Depositing OrganizationInstitute of Genetics and Developmental Biology, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGGA000
- Backbone size w/o insert (bp) 2686
-
Vector typePlant Expression, CRISPR ; GreenGate cloning entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3-
-
Alt nameAtU6-29 promoter-FT guide RNA2-AtU6-29 promoter-FT guide RNA4-
-
Alt nameAtU3b promoter-FT guide RNA5-AtU3b promoter-FT guide RNA6-AtU3d promoter-FT guide RNA7
-
gRNA/shRNA sequenceacccgagttaatgcaaatcc, tggttaaaaatgccccacgc, CTCTTTGGCCATAAGTAAC, ttaagatactctctgctata, CCGAGAATATCTCCATTGgt, TGCTACAACTGGAACAACCt, CGGGAAGGCCGAGATTGTAG
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)3069
-
Entrez GeneFT (a.k.a. AT1G65480, F5I14.3, F5I14_3, FLOWERING LOCUS T, REDUCED STEM BRANCHING 8, RSB8)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer atgtgagttagctcactcattaggcac
- 3′ sequencing primer gcaaggcgattaagttgggtaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGGA-FT guide RNA1_7 was a gift from Danhua Jiang (Addgene plasmid # 246797 ; http://n2t.net/addgene:246797 ; RRID:Addgene_246797)