DBJS-p2.16
(Plasmid
#246893)
-
PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for CAPRIN1 Nterm.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX332
- Backbone size w/o insert (bp) 8484
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaprin1 Nterm Guide RNA 1
-
gRNA/shRNA sequenceGAGGGCATCTTCAGACCGCA
-
SpeciesH. sapiens (human)
-
Entrez GeneCAPRIN1 (a.k.a. GPIAP1, GPIP137, GRIP137, M11S1, RNG105, p137GPI)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
- 3′ cloning site Unspecified (unknown if destroyed)
- 5′ sequencing primer Unspecified
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DBJS-p2.16 was a gift from David Bartel (Addgene plasmid # 246893 ; http://n2t.net/addgene:246893 ; RRID:Addgene_246893)