pFP59
(Plasmid #247215)

• Purpose: Expresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.
• Depositing Lab: Elizabeth Strychalski
• Publication: Piorino et al ACS Synth Biol. 2026 Jan 16;15(1):243-261. doi: 10.1021/acssynbio.5c00677. Epub 2025 Dec 24.

Backbone

• Vector backbone: pJL1
• Total vector size (bp): 2650
• Modifications to backbone: The Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds) was inserted into pJL1 downstream of the sfGFP gene. The T7 promoter was replaced with Pj23100 (Anderson promoter collection).
• Vector type: Bacterial Expression, Synthetic Biology ; E. coli-based cell-free expression.

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: E. coli DH5alpha and DH10B are suitable for growth.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: superfolder GFP
• Alt name: sfGFP
• Alt name: sfGFP-strepTag
• Insert Size (bp): 723
• Promoter: Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)
• Tag / Fusion Protein:
  • Streptavidin tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gtttcgccacctctgacttg

Gene/Insert 2

• Gene/Insert name: Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
• Alt name: tDF30ppr
• Insert Size (bp): 214
• Mutation: Two mutations were made to the second Pepper unit (G9A and C42T)
• Promoter: Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTGCCGGATAATCATTATCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Pepper RNA aptamer was originally developed by Chen et al. (https://doi.org/10.1038/s41587-019-0249-1) and grafted onto tRNA and F30 scaffolds by Mumbleau et al. (https://doi.org/10.1021/acssynbio.4c00009) To insert the aptamer into pJL1, we purchased the Pepper aptamer sequence from Integrated DNA Technologies (IDT) as part of a gBlock with two point mutations in one of the Pepper units to increase the likelihood of successful synthesis.