pFP59
(Plasmid
#247215)
-
PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.
-
Depositing Lab
-
Depositing OrganizationNational Institute of Standards and Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJL1
- Total vector size (bp) 2650
-
Modifications to backboneThe Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds) was inserted into pJL1 downstream of the sfGFP gene. The T7 promoter was replaced with Pj23100 (Anderson promoter collection).
-
Vector typeBacterial Expression, Synthetic Biology ; E. coli-based cell-free expression.
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE. coli DH5alpha and DH10B are suitable for growth.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesuperfolder GFP
-
Alt namesfGFP
-
Alt namesfGFP-strepTag
-
Insert Size (bp)723
- Promoter Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)
-
Tag
/ Fusion Protein
- Streptavidin tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gtttcgccacctctgacttg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
-
Alt nametDF30ppr
-
Insert Size (bp)214
-
MutationTwo mutations were made to the second Pepper unit (G9A and C42T)
- Promoter Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTGCCGGATAATCATTATCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Pepper RNA aptamer was originally developed by Chen et al. (https://doi.org/10.1038/s41587-019-0249-1) and grafted onto tRNA and F30 scaffolds by Mumbleau et al. (https://doi.org/10.1021/acssynbio.4c00009) To insert the aptamer into pJL1, we purchased the Pepper aptamer sequence from Integrated DNA Technologies (IDT) as part of a gBlock with two point mutations in one of the Pepper units to increase the likelihood of successful synthesis.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFP59 was a gift from Elizabeth Strychalski (Addgene plasmid # 247215 ; http://n2t.net/addgene:247215 ; RRID:Addgene_247215) -
For your References section:
Characterizing Cell-Free Transcription and Translation Dynamics with Nucleic Acid-Based Assays. Piorino F, Sundberg C, Strychalski EA, Romantseva E. ACS Synth Biol. 2026 Jan 16;15(1):243-261. doi: 10.1021/acssynbio.5c00677. Epub 2025 Dec 24. 10.1021/acssynbio.5c00677 PubMed 41444210